Micro and Nanosystems - Volume 11, Issue 2, 2019

Background: With the shrinking device-sizes in the present day world, the leakage power of the devices has also been increased significantly. Several techniques have been proposed to minimize the leakage power. However, the techniques have certain limitations, such as noise, delay or area of the chip. We have also proposed a leakage minimization technique which also minimizes the noise in the circuit. Objective: In this paper, we propose noise minimization circuit techniques for the distributed sleep transistor network in power-gated Multi-threshold CMOS circuits. The objective is to minimize leakage power as well as the noise associated with digital power-gated circuits. Method: The proposed technique has been verified through simulations using the Cadence virtuoso tool. The proposed technique has been applied to a 16-bit adder circuit in 45 nm MTCMOS technology. Results: The proposed techniques i.e. HVT-ST and the Hybrid-ST techniques achieve 99%, 64.8% and 62.07% reduction in noise as compared to the All-ON, variable-width and variable gate-voltage techniques, respectively. The behavior of the circuit techniques has also been analyzed at higher temperatures. It has been shown through simulations that the proposed techniques effectively minimize noise at higher temperatures i.e. 75°C and 115°C. The proposed techniques also minimize leakage power and the on-time delay significantly. A layout of the section of the proposed circuit has also been drawn which occupies the chip area of 2.37 μm2. Conclusion: The proposed techniques i.e. HVT-ST and the Hybrid-ST techniques achieve a significant reduction in the noise as well as delay. In this paper, we propose leakage minimization techniques for the distributed sleep transistor network. The proposed techniques i.e. HVT-ST and the Hybrid-ST techniques achieve a significant reduction in noise as well as delay. The technique also reduces the leakage power significantly.

Background: Due to wide band gap and large excitonic binding energy, being inexpensive, abundance in nature and easy synthesis ZnO is a promising candidate in many applications such as solar cells. Experimental: In the current work a series of ZnO thin films were deposited on glass substrates using sol-gel method to investigate the change in optical behavior of the film with sol aging time (asprepared, 8, 16, 24 and 32 hours) and the annealing temperature (300#146;C and 500#146;C). The optical properties of thin films were explored using spectroscopic ellipsometry method including the real and imaginary part of refractive index, real and imaginary part of dielectric function and band gap energy of the layers in the 300-900 nanometer wavelength range. Results: It can be deduced from the results that sol aging time and annealing temperature, affect the optical properties of the samples. Using single oscillator energy model of Wemple and Di Domenico parameters such as free charge carrier concentration ratio to effective mass, and plasma frequency, were calculated. Conclusion: The films prepared using 24 h aged solution, had the highest transmittance and the largest band gap energy.

Object: Copper oxide (CuO) nanoparticles (NPs) and copper oxide doped with various percentage of nickel (Ni) have been successfully prepared using the solid-solid reaction method. Methods: The obtained powders of these CuO NPs have been calcined at various temperatures of 350°C, 450°C, 550°C and 650°C. These NPs have been characterized by Differential Thermal Analysis (DTA), X-Ray diffraction (XRD), Field Emission Scanning Electron Microscope (FESEM) and Fourier Transformation Infrared Spectroscopy (FTIR). Results: XRD results obtained a pure phase of the as-prepared CuO NPs. The average crystallite size determined from XRD increases with certain calcination temperature. Doping of Ni in CuO NPs is extensively studied. The increase of Ni from 0.5% to 10% causes a decrease in the average crystallite size observed in FESEM studies. Moreover, magnetic properties are investigated for as-prepared CuO, CuO calcined at 650°C, and CuO doped 10% Ni. Conclusion: The magnetic observations illustrated that, at the maximum applied field of 1.5 kOe, the magnetic response with a maximum moment M ≤ 0.01 emu/g for CuO NPs is achieved. This could be related to the uncompensated surface spins. Moreover, the magnetic response with a maximum moment is doubled in CuO NPs doped with 10% Ni.

Background: Ampicillin has been widely used as a broad-spectrum antibiotic for the treatment and prevention of human diseases with a low-toxicity. Ampicillin plays an important role in therapeutics, however, there might be some synthetically prepared compounds for the applications in agriculture, animals and even humans that eventually have resulted in major health issues. Objective: This research demonstrates the approach to improve the specific in vitro detection of ampicillin using titanium dioxide nanoparticle-based interdigitated device electrode. Methods: The fabrication of biosensor was performed using the conventional photolithography integrated process of an inductively-coupled plasma dry-etching. Surface modifications were applied on a 50 μm gapped interdigitated comb-like titanium dioxide nanoparticle modified electrode surface using 0.02 M of 3-Aminopropyl trimethoxysilane, which was diluted in 75% ethanol. A Schiff-base reaction using glutaraldehyde was followed to covalently immobilize streptavidin followed by a non-covalent immobilization of biotinylated-aptamer DNA probe (1 μM), having a sequence of 5’- CACGGCATGGTGGGCGTCGTG–biotin-3’. Results: These surface modifications with multiple self-assembling monolayers afford the additional control for stability. The immobilized aptamer DNA probe was interacted with the target, ampicillin at 10 mg/ml, resulting in the current field changes across the device. I-V relationship interpreted the selective binding of ampicillin and distinguished kanamycin from carbenicillin. Our sensing system was able to detect ampicillin in a linear range of 0.1 ng until 10 mg/ml with the limit of detection at 0.1 ng/ml. Conclusion: This sensing platform aimed to evaluate the purity of ampicillin, a promising beneficial approach towards the pharmaceutical industries.

Background: In recent years, with the progress of human civilization, environmental pollution is aggravating. Among them, heavy metal pollution is one of the greatest harmful water pollution problems. As a global pollution problem, heavy metal pollution, such as lead, has been given more attention by scientists. How to solve this problem, is an interesting issue. Objective: The aims of the current study are to develop the optimized adsorption conditions of Pb2+ by an MCM (Mobil Composition of Matter)-48 mesoporous molecular sieve material and study the properties of this adsorption. Methods: First, an MCM-48 mesoporous molecular sieve was prepared by the hydrothermal method by using cetyltrimethylammonium as the template and tetraethyl orthosilicate as the silica source. The prepared sample was characterized by powder X-ray diffraction and scanning electron microscopy. Then, a harmful heavy metal Pb2+ was adsorbed by MCM-48. Effects of acidity, contact time, temperature, the initial concentration of lead(II) and the dosage of adsorbent on the rates of adsorption were studied, and the optimum adsorptive conditions were obtained. Results: The results show that when pH value was 4.5, the temperature was 18 ± 1°C, contact time was 40 min and m(MCM-48): m(Pb2+) = 2.5 (mass ratio), the adsorptive effect was the best, the adsorption rate was 96.71% and the adsorptive capacity was 386.84 mg/g. After the kinetic calculation, it was known that the process of the adsorption of Pb2+ by MCM-48 conforms to the pseudo-secondorder kinetic equation. Thermodynamic calculation shows that the adsorption is an exothermic process. The adsorption obeys the Freundlich adsorption isotherm equation. Nitric acid, hydrochloric acid and acetic acid were used to study the effects of desorption, indicating that the desorptive effect was the best using 0.1 mol/L of nitric acid as a desorptive agent. At the time of desorption 6 h, its desorptive ratio was the highest and reached 71.11%. Conclusion: This method is an alternative for removing harmful substances containing lead, which has a potential for application in processing lead-polluted waters.

This paper brings in a new design, namely, voltage mode differentiator with an active element, Carbon Nanotube Field Effect Transistors Voltage Difference Transconductance Amplifier (CNVDTA). The circuit thus proposed needs one Carbon Nanotube Field Effect Transistors Voltage Difference Transconductance Amplifier (CNVDTA) element and a single capacitor. While fabricating IC’s in VLSI design, the proposed circuit proves more adaptable and applicable with the anticipated results. Methods: The proposed CNVDTA based voltage mode differentiator in CNFET technology was simulated at 32 nm at a voltage supply of ±0.9 V using the Cadence Virtuoso CAD tool. Results: It is also reported that the proposed circuit would function with ±0.9 V supply voltage and would also take care of the bias current of the order of 150 μA. Further, on the part of the transconductance (gm), it is electronically tunable with the help of bias current. Conclusion: The CNVDTA based differentiator has been found to be very useful in the triggering circuit of CRO’s, wave shaping circuits, power control circuits etc. It is also found useful in detecting the high-frequency components in the input signals.

Background: Nateglinide is an antidiabetic drug having biological half-life 1.5 h which shows a concise effect. Graphene oxide along with chitosan can be used as a nanocarrier for sustained release of Nateglinide. Objective: To develop Nateglinide loaded graphene oxide-chitosan nanocomposites and to evaluate for different characterization studies. Methods: Graphene Oxide (GO) was synthesized by improved hummer’s method and drug-loaded Graphene oxide - chitosan nanocomposites were prepared. Box Behnken design was used to carry out experiments. The nanocomposites were characterized for encapsulation efficiency and drug release. Morphology was studied using field emission scanning electron microscope and transmission electron microscope. An interaction between drug, polymer and GO was investigated by Fourier transform infrared spectroscopy and X-ray diffractometer along with in vitro drug release study. Results: The statistical evaluation of the design showed linear and quadratic models which are significant models for encapsulation efficiency (R1 0.6883, 0.9473) and drug loading (R2 0.6785, 0.9336), respectively. Fourier transform infrared spectroscopy showed the compatibility of GO, Chitosan and Nateglinide. X-ray diffractometer reveals the change in degree of crystallinity of drug. FE-SEM and TEM images confirmed the distribution of the drug within the nanocomposites. Design expert reveals that the concentration of GO has great influence on encapsulation efficiency. In Vitro drug release showed the sustained release of drug over the period of 12 h. Conclusion: GO-Chitosan nanocomposites can be used as a sustained release carrier system for Nateglinide to reduce dose frequency of drug as well as its probable side effects.

Objective: This study investigated the optimization of thermal energy consumption using electrochromic components with a new nanocomposite layer (WO3+Ag) in a larger size (window) for a room with an educational application for five cities with different climatic conditions in Iran (Yazd, Tehran, Bandar Abbas, Tabriz, and Sari). Materials and Methods: For this simulation platform, the software was implemented in Energy Plus. This feasibility study was modeled by DesignBuilder software which reported reduced thermal energy consumption across all climates in Iran (hot and dry, warm and semi-humid, warm and wet, moderate and dry, and mild and humid.). Four strategies were considered for better comparison. The first strategy used for common double-glazed windows, while the second to fourth strategies involved the use of the electrochromic window in three different modes; bleached mode (Off), colored mode (On), and switchable mode (controlled below comfort conditions). Results: The third and fourth strategies indicated a reduction in thermal energy consumption in different climates from 25 to 45% relative to typical windows. The best result of cooling energy consumption was observed in Tehran. Conclusion: For this climate, the average energy consumption dropped to 34% for the warm months of the year and even 42% for the warmest month of the year (August).